Python Interpreters Benchmarks
x64 ArchLinux : AMD® Ryzen 7 4700U®

 performance measurements

Each table row shows performance measurements for this program with a particular command-line input value N.

 N  CPU secs Elapsed secs Memory KB Code B ≈ CPU Load

Read the ↓ make, command line, and program output logs to see how this program was run.

Read  benchmark to see what this program should do.

 notes

  source code

# The Computer Language Benchmarks Game
# http://benchmarksgame.alioth.debian.org/
#
# modified by Ian Osgood
# modified again by Heinrich Acker
# 2to3

import sys, bisect

alu = (
   'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG'
   'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA'
   'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT'
   'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA'
   'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG'
   'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC'
   'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA')

iub = list(zip('acgtBDHKMNRSVWY', [0.27, 0.12, 0.12, 0.27] + [0.02]*11))

homosapiens = [
    ('a', 0.3029549426680),
    ('c', 0.1979883004921),
    ('g', 0.1975473066391),
    ('t', 0.3015094502008),
]


def genRandom(lim, ia = 3877, ic = 29573, im = 139968):
    seed = 42
    imf = float(im)
    while 1:
        seed = (seed * ia + ic) % im
        yield lim * seed / imf

Random = genRandom(1.)

def makeCumulative(table):
    P = []
    C = []
    prob = 0.
    for char, p in table:
        prob += p
        P += [prob]
        C += [char]
    return (P, C)

def repeatFasta(src, n):
    width = 60
    r = len(src)
    s = src + src + src[:n % r]
    for j in range(n // width):
        i = j*width % r
        print(s[i:i+width])
    if n % width:
        print(s[-(n % width):])

def randomFasta(table, n):
    width = 60
    r = range(width)
    gR = Random.__next__
    bb = bisect.bisect
    jn = ''.join
    probs, chars = makeCumulative(table)
    for j in range(n // width):
        print(jn([chars[bb(probs, gR())] for i in r]))
    if n % width:
        print(jn([chars[bb(probs, gR())] for i in range(n % width)]))


n = int(sys.argv[1])

print('>ONE Homo sapiens alu')
repeatFasta(alu, n*2)

print('>TWO IUB ambiguity codes')
randomFasta(iub, n*3)

print('>THREE Homo sapiens frequency')
randomFasta(homosapiens, n*5)

 make, command-line, and program output logs

 Wed, 28 Sep 2022 08:59:25 GMT

COMMAND LINE:
 /usr/bin/micropython fasta.micropython-2.micropython 2500000

PROGRAM FAILED 


PROGRAM OUTPUT:

Traceback (most recent call last):
  File "fasta.micropython-2.micropython", line 8, in <module>
ImportError: no module named 'bisect'

Revised BSD license

  Home   Conclusions   License   Play